Dimebon stimulates activation of autophagy-related events in cell culture

I.V. Khritankova, O.A. Lytkina, M.S. Kukharskiy

Institute of Physiologically Active Substances, Russian Academy of Sciences,

1 Severnyi proezd, Chernogolovka, 142432, Moscow Region, Russian

Dimebon stimulates activation of autophagy-related events in cell culture

INTRODUCTION

Dimebon was originally designed as an antihistamine drug but it experienced a revival of interest in connection with neurodegenerative disorders [1]. Dimebon inhibits aggregation of aggregate-prone proteins in cell cultures [2] and slows proteinopathy progression by hindering amyloid inclusion formation in neuroblastoma cells of transgenic mice [3, 4]. Nutrient depletion as well as other environmental cues such as immune defense can induce autophagy. The complexity of autophagy regulation suggests that signal timing and intensity are important in conveying the right physiological message. ERK1/2 pathway inhibition by pretreatment with PD98059 suppresses autophagy [5] whereas sustained ERK activation for more than 24 hours can block autophagosome maturation [6]. Failure to remove protein inclusions often cause neurodegeneration and this was shown on a few animal models such as conditional deletion of Atg5 (autophagy-related 5) in mouse neurons. Atg5 conjugates with Atg12 and subsequent addition of Atg16 forms an ubiquitin-like conjugating system recruited to autophagosome membrane to mediate its expansion [7]. Concomitant expression shifts in all three members of the complex might serve as an indication of actived autophagy program, therefore we decided to assess dimebon effects on Atg12 and Atg16 in SH-SY5Y cells as well. Another objective was to examine whether dimebon treatment affects MAP kinases activation, particularly ERK1/2 and p38. ERK1/2 phosphorylation is commonly used as indicator of proliferative or anti-apoptotic signalling and can induce autophagy in response to anti-tumour agents. At the same time p38 is an important mediator of stress response but its implication in autophagy has been controversial. Recent data suggested that although p38 and ERK1/2 can be activated simultaneously, p38 can inhibit ERK1/2 – directed autophagy [6]. The aim of this study was to assess whether dimebon has an impact on autophagy-related gene transcription in SH-SY5Y human neuroblastoma cell line.

MATERIALS AND METHODS

SH-SY5Y human neuroblastoma cells were cultivated in DMEM/F12 medium (Sigma) supplemented with 10% fetal calf serum, penicillin-streptomycin (10000 1U/ml-10000µg/ml), L-glutamine (Sigma), and MEM non-essential amino acids solution (Gibco). 24 hrs after seeding the culture medium was supplemented with 10 μM of dimebon and further incubated for 30 min, 1 hr, 2 hr, 3 hr and 6 hrs. Cells were washed on ice with cold PBS and collected either for protein extraction and western blotting or for RNA isolation, cDNA synthesis and quantitative RT-PCR.

Protein concentrations were determined using a Coomassie based method (Bio-Rad, USA). Equal amounts of total protein (20 μg) were separated on 10% polyacrylamide gel and subsequently transferred on Hybond-P membrane (GE Healthcare, UK) for western blotting. HRP-conjugated secondary antibody (Amersham Biosciences, USA) was used (dilution 1:3000) for protein detection using ECL reagent (Amersham Biosciences, USA). The primary antibodies were as follows: rabbit polyclonal phospho-p38 MAPK (Thr180/Tyr182), 1:1000 (Cell Signaling, USA), phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204), 1:1000 (Cell Signaling, USA) and rabbit polyclonal GAPDH, 1:1000 (Santa Cruz, USA).

Gene expression levels were analyzed via real-time, quantitative PCR. Total RNA was extracted using TRIzol (Invitrogen, USA) and standard phenol-chloroform protocol. Reverse transcription was performed with SuperScript III reverse transcriptase (Invitrogen, USA) and random hexamers (Invitrogen, USA) according to the manufacturer’s instructions. The PTC-200 Peltier thermal cycler (MJ Research) and Chromo4 fluorescence detector (MJ Research) were used in conjunction with Opticon Monitor analysis software (version 2.03, MJ Research) to calibrate and run the reaction. The sequences for primers used were as follows (primers were designed using primer3^TM software):

human ATG5 CTCCGCGCCGGTGCTTTTTG (forward) and

CAGATTCCGCGCTCCGGTGG (reverse),

human ATG12 CCCCGTCTTCCGCTGCAGTT (forward) and

TCGTGTTCGCTCTACTGCCCACT (reverse),

human ATG16 AGCCCGGCTGCAGAAAGAGC (forward) and

TGCTCTGCTGATGGCTCGCA (reverse),

human ribosomal protein L13a GCATCCCACCGCCCTACGAC (forward) and

CCAGCCAACCTCGTGAGCCA (reverse).

The fold change was determined using 2^-ΔΔCT method using ribosomal protein L13a as a reference gene for all the samples.

RESULTS

Our data shows that dimebon treatment resulted in a quick increase in ERK1/2 and p38 phosphorylation. Their activation levels reached maximum within 30 minutes after the start of dimebon treatment but the signal lower at 2hr and 6hr timepoints. Although phospho-ERK signal intensity declined after the initial peak it was still stronger than basal levels (Fig. 1, A). Transient ERK phosphorylation is essential for autophagy whereas sustained and strong activation can block autophagosome maturation [6]. Phospho-p38 levels followed a similar pattern in dimebon-treated cells but it returned back to pre-treatment levels at 1hr timepoint and decreased below the basal level at 2hr and 6hr (Fig 1, A). The data suggests that dimebon not only stimulates a short-lived boost in ERK1/2 and p38 phosphorylation in SH-SY5Y cells but it can also elicit a more prolonged effect judging from the ratio between phospho-ERK1/2 and phospho-p38 at the later timepoints. ERK1/2 and p38 are known to be engaged in a complex interplay when regulating autophagy: ERK stimulation activates autophagy, the concomitant p38 upregulation blocks autophagic vacuolation. Strong and sustained p38 activation often corresponds to stress-induced apoptosis whereas autophagy regarded as a survival mechanism. ERK1/2 phosphorylation boost in dimebon treated SH-SY5Y cells was accompanied by transcriptional increases in autophagy markers such as Atg5-Atg12-Atg16 ubiquitin-like conjugating system (Fig 1, B). Real-time quantitative PCR data showed enhanced mRNA levels for all three members of the complex: levels of Atg5 and Atg12 experienced a transient but smooth rise peaking around 2-3 hrs post-treatment whereas Atg16 expression was maximal at 1 hr (Fig 1, B). Atg5 is known to be covalently linked with Atg12 with Atg16 subsequently joining Atg12-Atg5 conjugate [7]. The tight link between Atg5, Atg12 and Atg16 must be reflected on a transcriptional level as well and the observed synchronized increase in Atg5, Atg12 and Atg16 levels might indicate that dimebon-treated SH-SY5Y cells experience an activation of autophagy program.

Figure 1 – Dimebon activates MAP kinases and induces autophagy-related gene expression. A: western blot analysis of phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) and phospho-p38 MAPK (Thr180/Tyr182) in SH-SY5Y cells. B: real time quantitative PCR results showing increases in mRNA for ATG5-ATG12-ATG16 complex

CONCLUSION

Our data shows that dimebon might stimulate autophagy response. We observed a transient boost in ERK1/2 and p38 phosphorylation in dimebon-treated SH-SY5Y neuroblastoma cells and this corresponded to activated transcription of several autophagy-related genes: Atg5-Atg12-Atg16 ubiquitin-like conjugating system.

REFERENCES

1. Doody S., Gavrilova S.I., Sano M., Thomas R.G., Aisen P.S., Bachurin S.O., Seely L. and Hung D. Effect of dimebon on cognition, activities of daily living, behaviour, and global function in patients with mild-to-moderate Alzheimer’s disease: a randomised, double-blind, placebo-controlled study// Lancet. – 2008 – vol. 372. – P. 207–215.

2. Yamashita M., Nonaka T., Arai T., Kametani F., Buchman V.L., Ninkina N., Bachurin S.O., Akiyama H., Goedert M. and Hasegawa M. Methylene blue and dimebon inhibit aggregation of TDP-43 in cellular models// FEBS Lett – 2009 – vol. 583. – P.2419–2424.

3. Bachurin S.O., Shelkovnikova T.A., Ustyugov A.A., Peters O., Khritankova I., Afanasieva M.A., Tarasova T.V., Alentov I.I., Buchman V.L. and Ninkina N.N. Dimebon Slows Progression of Proteinopathy in γ-Synuclein Transgenic Mice// Neurotox Res – 2011 – Epub 17 Dec 2011; PMID:22179976

4. Bachurin S.O., Ustyugov A.A., Peters O., Shelkovnikova T.A., Buchman V.L. and Ninkina N.N. Hindering of proteinopathy-induced neurodegeneration as a new mechanism of action for neuroprotectors and cognition enhancing compounds// Doklady Biochemistry and Biophysics – 2009 – vol. 428. – P. 235-238

5. Ogier-Denis E., Pattingre S., El Benna J. and Codogno P. Erk1/2-dependent phosphorylation of Galpha-interacting protein stimulates its GTPase accelerating activity and autophagy in human colon cancer cells// J Biol Chem. – 2000 – vol. 275(50). – P. 39090-5.

6. Corcelle E., Nebout M., Bekri S., Gauthier N., Hofman P., Poujeol P., Fénichel P., and Mograbi B. Disruption of autophagy at the maturation step by the carcinogen lindane is associated with the sustained mitogen-activated protein kinase/extracellular signal-regulated kinase activity// Cancer Res. – 2006 – vol. 66(13). – P. 6861-70.

7. Matsushita M., Suzuki N.N., Obara K., Fujioka Y., Ohsumi Y. and Inagaki F. Structure of Atg5.Atg16, a complex essential for autophagy// J Biol Chem. – 2007 – vol. 282(9). – P. 6763-72.