Kussainova A., Ondybaуeva S.B., Bulgakovа O.V.

L.N.Gumilyov Eurasian National University

The polymorphisms of DNA reparation genes -XRCC1 and XRCC3 in the Kazakhstan population.

Lung cancer ( LC ) is a leader in the structure of cancer incidence of men, who suffer from it almost 7 times more likely than women . According to the International Agency for Research on Cancer, in the world each year nearly 1 million new cases of lung cancer registered, 60 % of cancer patients die from this disease.

The main causes of carcinogenesis is a failure in the control of processes of proliferation, DNA reparation, apoptosis and detoxification of carcinogens, not only due to genetic and epigenetic disorders, but also caused by the variability of gene function due to genetic polymorphism.

There are several genetic polymorphisms in genes whose products are involved in DNA reparation mechanisms. XRCC1 enzyme plays a key role in the excision repairtion of DNA.

Actually described three encoding polymorphisms of gene XRCC1 in the codons 194 (Arg to Trp), 280 (Arg to His), and 399 (Arg to Gln). Arg399Gln polymorphism of 10th exon affects its central domain, which is required to activate the BER (base excision repair). There is evidence that this polymorphism is associated with lung cancer risk , but an analysis of published data showed quite contradictory results about polymorphism Arg399Gln and its association with lung cancer .

As for polymorphisms Arg194Trp and Arg280His, there was no association with lung cancer risk in European population . Wang and others carried out 30 studies of polymorphism XRCC1 Arg399Gln in form of case-control studies and 16 studies of polymorphisms Arg194Trp. Their results showed that the specific XRCC1 codons 399 and 194 may affect the predisposition to lung cancer.

In the process of reparation of double-strand DNA breaks and recombination of DNA reparation is likely involved XRCC3. DNA double strand breaks - the most common form of DNA damage caused by radiation exposure, reparation is possible by means of two mechanisms - reparation by homologous recombination (HRR - homologous recombination repair) and reparation of non-homologous end (non-homologous end-joining). HRR mechanism consists at least of 16 protein components, including XRCC3. Polymorphism of XRCC3 in exon 7 leads to the replacement of an amino acid at codon 241 (Thr241Met), which may affect the function of the enzyme and/or interaction with other proteins involved in the reparation process of DNA damages. In many literary sources mention a significant reduction in the risk of lung cancer in the European population for carriers of polymorphism XRCC3 T241M. However, studies of this polymorphism conducted in Asian populations revealed no significant association between the XRCC3 T241M and the development of lung cancer. It can be assumed that the inconsistency of these results may be due to differences in ethnicity, lifestyle and spread of the disease. In connection with the above, we set a goal - to study population characteristics of DNA reparation genes polymorphisms (XRCC1 and XRCC3) in the Kazakhstan population of healthy people, chosen as a control group for the study of the role of polymorphisms of genes XRCC1 and XRCC3 in the pathogenesis of lung cancer.

The study included 70 volunteers without lung pathology. Of all the surveyed 73% were males, 27 % - females, the age range was from 42 to 80 years (60,2 ± 8,6 years).

Genomic DNA was isolated from whole venous blood, followed by phenol- chloroform extraction ( K. Davis , 1990).

Evaluation of genes polymorphisms was performed by PCR and PCR - RFLP analysis (conditions see in Table 1). Visualization of PCR - RFLP reaction was conducted by gel electrophoresis. The amplification or restriction products were analyzed in agarose or polyacrylamide gel. 2% agarose gel was used.

Table 1. Analysis conditions of locus polymorphism of studied genes

Gene	Sequence of primers	Annealing temperature (°C)	Restriction enzymes
XRCC1 Arg194Trp	5´GCCCCGTCCCAGGTA3´, 5´AGCCCCAAGACCCTTT3´	57	PvuII
XRCC1 Arg399Gln	5´CAAGTACAGCCAGGTCCTAG3´, 5´CCTTCCCTCACTGGAGTAC-3´	55	NciI
XRCC3 Thr241Met	5´GCCTGGTGGTCATCGACTC3´ R 5´ACAGGGCTCTGGAAGGCACT GCTCAGCTCACGCACC-3´	60	NcoI

The genotype frequencies of gene XRCC1 Arg194Trp in the kazakh population was as follows: homozygous carriers of the normal allele Arg/Arg accounted for 73% of the total (51/70), the heterozygote Arg/Trp 16% (11/70), and homozygous for the mutant allele Trp/Trp 11% (8/70), respectively. Thus, these data suggest the prevalence of normal variant alleles Arg/Arg in the control group represented by healthy people without lung pathology. Figure 1 shows the results of PCR-RFLP analysis of XRCC1 Arg194Trp polymorphism.

500 b.p

1 2 3 4 5 6 7 8 9 10

Figure 1 - Examples of identification of genotypes in the gene XRCC1 Arg194Trp

The tracks 3,5,8 are heterozygous variant Arg / Trp (fragment length after restriction 490/294/196 b.p.).

In the case of polymorphism of XRCC1 Arg399Gln homozygous carriers of the normal allele Arg/Arg accounted for 37 % of the total (26/70), heterozygous Arg/Gln 26% (18/70), and homozygous for the mutant allele Gln/Gln 37% (26/70), respectively.

Thus, in the control group of healthy individuals was equal to the number of carriers of both normal alleles Arg/Arg, and mutant alleles Gln/Gln.

In the Kazakhstan population are homozygous carriers of the normal allele XRCC3 Trp/Trp is 26% of the total (18/70) , heterozygous Trp/Met 72% (50/70), and homozygous for the mutant allele Met/Met 2% (2/70). These data suggest the prevalence of heterozygous variant allele Trp/Met in the control group represented by healthy people without lung patholog .

Figure 2 shows the results of PCR-RFLP analysis of the polymorphism of XRCC3 Thr241Met.

200 b.p

Figure 2 - Examples of identification of genotypes in the gene XRCC3 Thr241Met

Tracks 2, 8 are homozygous mutant variant Met/Met (fragment length after restriction 97/39 b.p.); 3,7,9,10 tracks - homozygous normal allele Trp/Trp (136 b.p.); tracks 4,5,6 - heterozygous allele Trp/Met (fragment length after restriction 136/97/39 b.p.)